mirror of
https://github.com/python/cpython.git
synced 2025-10-26 00:08:32 +00:00
1482 lines
43 KiB
Python
Executable file
1482 lines
43 KiB
Python
Executable file
|
|
# Various microbenchmarks comparing unicode and byte string performance
|
|
# Please keep this file both 2.x and 3.x compatible!
|
|
|
|
import timeit
|
|
import itertools
|
|
import operator
|
|
import re
|
|
import sys
|
|
import datetime
|
|
import optparse
|
|
|
|
VERSION = '2.0'
|
|
|
|
def p(*args):
|
|
sys.stdout.write(' '.join(str(s) for s in args) + '\n')
|
|
|
|
if sys.version_info >= (3,):
|
|
BYTES = bytes_from_str = lambda x: x.encode('ascii')
|
|
UNICODE = unicode_from_str = lambda x: x
|
|
else:
|
|
BYTES = bytes_from_str = lambda x: x
|
|
UNICODE = unicode_from_str = lambda x: x.decode('ascii')
|
|
|
|
class UnsupportedType(TypeError):
|
|
pass
|
|
|
|
|
|
p('stringbench v%s' % VERSION)
|
|
p(sys.version)
|
|
p(datetime.datetime.now())
|
|
|
|
REPEAT = 1
|
|
REPEAT = 3
|
|
#REPEAT = 7
|
|
|
|
if __name__ != "__main__":
|
|
raise SystemExit("Must run as main program")
|
|
|
|
parser = optparse.OptionParser()
|
|
parser.add_option("-R", "--skip-re", dest="skip_re",
|
|
action="store_true",
|
|
help="skip regular expression tests")
|
|
parser.add_option("-8", "--8-bit", dest="bytes_only",
|
|
action="store_true",
|
|
help="only do 8-bit string benchmarks")
|
|
parser.add_option("-u", "--unicode", dest="unicode_only",
|
|
action="store_true",
|
|
help="only do Unicode string benchmarks")
|
|
|
|
|
|
_RANGE_1000 = list(range(1000))
|
|
_RANGE_100 = list(range(100))
|
|
_RANGE_10 = list(range(10))
|
|
|
|
dups = {}
|
|
def bench(s, group, repeat_count):
|
|
def blah(f):
|
|
if f.__name__ in dups:
|
|
raise AssertionError("Multiple functions with same name: %r" %
|
|
(f.__name__,))
|
|
dups[f.__name__] = 1
|
|
f.comment = s
|
|
f.is_bench = True
|
|
f.group = group
|
|
f.repeat_count = repeat_count
|
|
return f
|
|
return blah
|
|
|
|
def uses_re(f):
|
|
f.uses_re = True
|
|
|
|
####### 'in' comparisons
|
|
|
|
@bench('"A" in "A"*1000', "early match, single character", 1000)
|
|
def in_test_quick_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("A")
|
|
for x in _RANGE_1000:
|
|
s2 in s1
|
|
|
|
@bench('"B" in "A"*1000', "no match, single character", 1000)
|
|
def in_test_no_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("B")
|
|
for x in _RANGE_1000:
|
|
s2 in s1
|
|
|
|
|
|
@bench('"AB" in "AB"*1000', "early match, two characters", 1000)
|
|
def in_test_quick_match_two_characters(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("AB")
|
|
for x in _RANGE_1000:
|
|
s2 in s1
|
|
|
|
@bench('"BC" in "AB"*1000', "no match, two characters", 1000)
|
|
def in_test_no_match_two_character(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("BC")
|
|
for x in _RANGE_1000:
|
|
s2 in s1
|
|
|
|
@bench('"BC" in ("AB"*300+"C")', "late match, two characters", 1000)
|
|
def in_test_slow_match_two_characters(STR):
|
|
s1 = STR("AB" * 300+"C")
|
|
s2 = STR("BC")
|
|
for x in _RANGE_1000:
|
|
s2 in s1
|
|
|
|
@bench('s="ABC"*33; (s+"E") in ((s+"D")*300+s+"E")',
|
|
"late match, 100 characters", 100)
|
|
def in_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = (m+d)*300 + m+e
|
|
s2 = m+e
|
|
for x in _RANGE_100:
|
|
s2 in s1
|
|
|
|
# Try with regex
|
|
@uses_re
|
|
@bench('s="ABC"*33; re.compile(s+"D").search((s+"D")*300+s+"E")',
|
|
"late match, 100 characters", 100)
|
|
def re_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = (m+d)*300 + m+e
|
|
s2 = m+e
|
|
pat = re.compile(s2)
|
|
search = pat.search
|
|
for x in _RANGE_100:
|
|
search(s1)
|
|
|
|
|
|
#### same tests as 'in' but use 'find'
|
|
|
|
@bench('("A"*1000).find("A")', "early match, single character", 1000)
|
|
def find_test_quick_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("A")
|
|
s1_find = s1.find
|
|
for x in _RANGE_1000:
|
|
s1_find(s2)
|
|
|
|
@bench('("A"*1000).find("B")', "no match, single character", 1000)
|
|
def find_test_no_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("B")
|
|
s1_find = s1.find
|
|
for x in _RANGE_1000:
|
|
s1_find(s2)
|
|
|
|
|
|
@bench('("AB"*1000).find("AB")', "early match, two characters", 1000)
|
|
def find_test_quick_match_two_characters(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("AB")
|
|
s1_find = s1.find
|
|
for x in _RANGE_1000:
|
|
s1_find(s2)
|
|
|
|
@bench('("AB"*1000).find("BC")', "no match, two characters", 1000)
|
|
def find_test_no_match_two_character(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("BC")
|
|
s1_find = s1.find
|
|
for x in _RANGE_1000:
|
|
s1_find(s2)
|
|
|
|
@bench('("AB"*1000).find("CA")', "no match, two characters", 1000)
|
|
def find_test_no_match_two_character_bis(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("CA")
|
|
s1_find = s1.find
|
|
for x in _RANGE_1000:
|
|
s1_find(s2)
|
|
|
|
@bench('("AB"*300+"C").find("BC")', "late match, two characters", 1000)
|
|
def find_test_slow_match_two_characters(STR):
|
|
s1 = STR("AB" * 300+"C")
|
|
s2 = STR("BC")
|
|
s1_find = s1.find
|
|
for x in _RANGE_1000:
|
|
s1_find(s2)
|
|
|
|
@bench('("AB"*300+"CA").find("CA")', "late match, two characters", 1000)
|
|
def find_test_slow_match_two_characters_bis(STR):
|
|
s1 = STR("AB" * 300+"CA")
|
|
s2 = STR("CA")
|
|
s1_find = s1.find
|
|
for x in _RANGE_1000:
|
|
s1_find(s2)
|
|
|
|
@bench('s="ABC"*33; ((s+"D")*500+s+"E").find(s+"E")',
|
|
"late match, 100 characters", 100)
|
|
def find_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = (m+d)*500 + m+e
|
|
s2 = m+e
|
|
s1_find = s1.find
|
|
for x in _RANGE_100:
|
|
s1_find(s2)
|
|
|
|
@bench('s="ABC"*33; ((s+"D")*500+"E"+s).find("E"+s)',
|
|
"late match, 100 characters", 100)
|
|
def find_test_slow_match_100_characters_bis(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = (m+d)*500 + e+m
|
|
s2 = e+m
|
|
s1_find = s1.find
|
|
for x in _RANGE_100:
|
|
s1_find(s2)
|
|
|
|
|
|
#### Same tests for 'rfind'
|
|
|
|
@bench('("A"*1000).rfind("A")', "early match, single character", 1000)
|
|
def rfind_test_quick_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("A")
|
|
s1_rfind = s1.rfind
|
|
for x in _RANGE_1000:
|
|
s1_rfind(s2)
|
|
|
|
@bench('("A"*1000).rfind("B")', "no match, single character", 1000)
|
|
def rfind_test_no_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("B")
|
|
s1_rfind = s1.rfind
|
|
for x in _RANGE_1000:
|
|
s1_rfind(s2)
|
|
|
|
|
|
@bench('("AB"*1000).rfind("AB")', "early match, two characters", 1000)
|
|
def rfind_test_quick_match_two_characters(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("AB")
|
|
s1_rfind = s1.rfind
|
|
for x in _RANGE_1000:
|
|
s1_rfind(s2)
|
|
|
|
@bench('("AB"*1000).rfind("BC")', "no match, two characters", 1000)
|
|
def rfind_test_no_match_two_character(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("BC")
|
|
s1_rfind = s1.rfind
|
|
for x in _RANGE_1000:
|
|
s1_rfind(s2)
|
|
|
|
@bench('("AB"*1000).rfind("CA")', "no match, two characters", 1000)
|
|
def rfind_test_no_match_two_character_bis(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("CA")
|
|
s1_rfind = s1.rfind
|
|
for x in _RANGE_1000:
|
|
s1_rfind(s2)
|
|
|
|
@bench('("C"+"AB"*300).rfind("CA")', "late match, two characters", 1000)
|
|
def rfind_test_slow_match_two_characters(STR):
|
|
s1 = STR("C" + "AB" * 300)
|
|
s2 = STR("CA")
|
|
s1_rfind = s1.rfind
|
|
for x in _RANGE_1000:
|
|
s1_rfind(s2)
|
|
|
|
@bench('("BC"+"AB"*300).rfind("BC")', "late match, two characters", 1000)
|
|
def rfind_test_slow_match_two_characters_bis(STR):
|
|
s1 = STR("BC" + "AB" * 300)
|
|
s2 = STR("BC")
|
|
s1_rfind = s1.rfind
|
|
for x in _RANGE_1000:
|
|
s1_rfind(s2)
|
|
|
|
@bench('s="ABC"*33; ("E"+s+("D"+s)*500).rfind("E"+s)',
|
|
"late match, 100 characters", 100)
|
|
def rfind_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = e+m + (d+m)*500
|
|
s2 = e+m
|
|
s1_rfind = s1.rfind
|
|
for x in _RANGE_100:
|
|
s1_rfind(s2)
|
|
|
|
@bench('s="ABC"*33; (s+"E"+("D"+s)*500).rfind(s+"E")',
|
|
"late match, 100 characters", 100)
|
|
def rfind_test_slow_match_100_characters_bis(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = m+e + (d+m)*500
|
|
s2 = m+e
|
|
s1_rfind = s1.rfind
|
|
for x in _RANGE_100:
|
|
s1_rfind(s2)
|
|
|
|
|
|
#### Now with index.
|
|
# Skip the ones which fail because that would include exception overhead.
|
|
|
|
@bench('("A"*1000).index("A")', "early match, single character", 1000)
|
|
def index_test_quick_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("A")
|
|
s1_index = s1.index
|
|
for x in _RANGE_1000:
|
|
s1_index(s2)
|
|
|
|
@bench('("AB"*1000).index("AB")', "early match, two characters", 1000)
|
|
def index_test_quick_match_two_characters(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("AB")
|
|
s1_index = s1.index
|
|
for x in _RANGE_1000:
|
|
s1_index(s2)
|
|
|
|
@bench('("AB"*300+"C").index("BC")', "late match, two characters", 1000)
|
|
def index_test_slow_match_two_characters(STR):
|
|
s1 = STR("AB" * 300+"C")
|
|
s2 = STR("BC")
|
|
s1_index = s1.index
|
|
for x in _RANGE_1000:
|
|
s1_index(s2)
|
|
|
|
@bench('s="ABC"*33; ((s+"D")*500+s+"E").index(s+"E")',
|
|
"late match, 100 characters", 100)
|
|
def index_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = (m+d)*500 + m+e
|
|
s2 = m+e
|
|
s1_index = s1.index
|
|
for x in _RANGE_100:
|
|
s1_index(s2)
|
|
|
|
|
|
#### Same for rindex
|
|
|
|
@bench('("A"*1000).rindex("A")', "early match, single character", 1000)
|
|
def rindex_test_quick_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("A")
|
|
s1_rindex = s1.rindex
|
|
for x in _RANGE_1000:
|
|
s1_rindex(s2)
|
|
|
|
@bench('("AB"*1000).rindex("AB")', "early match, two characters", 1000)
|
|
def rindex_test_quick_match_two_characters(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("AB")
|
|
s1_rindex = s1.rindex
|
|
for x in _RANGE_1000:
|
|
s1_rindex(s2)
|
|
|
|
@bench('("C"+"AB"*300).rindex("CA")', "late match, two characters", 1000)
|
|
def rindex_test_slow_match_two_characters(STR):
|
|
s1 = STR("C" + "AB" * 300)
|
|
s2 = STR("CA")
|
|
s1_rindex = s1.rindex
|
|
for x in _RANGE_1000:
|
|
s1_rindex(s2)
|
|
|
|
@bench('s="ABC"*33; ("E"+s+("D"+s)*500).rindex("E"+s)',
|
|
"late match, 100 characters", 100)
|
|
def rindex_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = e + m + (d+m)*500
|
|
s2 = e + m
|
|
s1_rindex = s1.rindex
|
|
for x in _RANGE_100:
|
|
s1_rindex(s2)
|
|
|
|
|
|
#### Same for partition
|
|
|
|
@bench('("A"*1000).partition("A")', "early match, single character", 1000)
|
|
def partition_test_quick_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("A")
|
|
s1_partition = s1.partition
|
|
for x in _RANGE_1000:
|
|
s1_partition(s2)
|
|
|
|
@bench('("A"*1000).partition("B")', "no match, single character", 1000)
|
|
def partition_test_no_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("B")
|
|
s1_partition = s1.partition
|
|
for x in _RANGE_1000:
|
|
s1_partition(s2)
|
|
|
|
|
|
@bench('("AB"*1000).partition("AB")', "early match, two characters", 1000)
|
|
def partition_test_quick_match_two_characters(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("AB")
|
|
s1_partition = s1.partition
|
|
for x in _RANGE_1000:
|
|
s1_partition(s2)
|
|
|
|
@bench('("AB"*1000).partition("BC")', "no match, two characters", 1000)
|
|
def partition_test_no_match_two_character(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("BC")
|
|
s1_partition = s1.partition
|
|
for x in _RANGE_1000:
|
|
s1_partition(s2)
|
|
|
|
@bench('("AB"*300+"C").partition("BC")', "late match, two characters", 1000)
|
|
def partition_test_slow_match_two_characters(STR):
|
|
s1 = STR("AB" * 300+"C")
|
|
s2 = STR("BC")
|
|
s1_partition = s1.partition
|
|
for x in _RANGE_1000:
|
|
s1_partition(s2)
|
|
|
|
@bench('s="ABC"*33; ((s+"D")*500+s+"E").partition(s+"E")',
|
|
"late match, 100 characters", 100)
|
|
def partition_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = (m+d)*500 + m+e
|
|
s2 = m+e
|
|
s1_partition = s1.partition
|
|
for x in _RANGE_100:
|
|
s1_partition(s2)
|
|
|
|
|
|
#### Same for rpartition
|
|
|
|
@bench('("A"*1000).rpartition("A")', "early match, single character", 1000)
|
|
def rpartition_test_quick_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("A")
|
|
s1_rpartition = s1.rpartition
|
|
for x in _RANGE_1000:
|
|
s1_rpartition(s2)
|
|
|
|
@bench('("A"*1000).rpartition("B")', "no match, single character", 1000)
|
|
def rpartition_test_no_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("B")
|
|
s1_rpartition = s1.rpartition
|
|
for x in _RANGE_1000:
|
|
s1_rpartition(s2)
|
|
|
|
|
|
@bench('("AB"*1000).rpartition("AB")', "early match, two characters", 1000)
|
|
def rpartition_test_quick_match_two_characters(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("AB")
|
|
s1_rpartition = s1.rpartition
|
|
for x in _RANGE_1000:
|
|
s1_rpartition(s2)
|
|
|
|
@bench('("AB"*1000).rpartition("BC")', "no match, two characters", 1000)
|
|
def rpartition_test_no_match_two_character(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("BC")
|
|
s1_rpartition = s1.rpartition
|
|
for x in _RANGE_1000:
|
|
s1_rpartition(s2)
|
|
|
|
@bench('("C"+"AB"*300).rpartition("CA")', "late match, two characters", 1000)
|
|
def rpartition_test_slow_match_two_characters(STR):
|
|
s1 = STR("C" + "AB" * 300)
|
|
s2 = STR("CA")
|
|
s1_rpartition = s1.rpartition
|
|
for x in _RANGE_1000:
|
|
s1_rpartition(s2)
|
|
|
|
@bench('s="ABC"*33; ("E"+s+("D"+s)*500).rpartition("E"+s)',
|
|
"late match, 100 characters", 100)
|
|
def rpartition_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = e + m + (d+m)*500
|
|
s2 = e + m
|
|
s1_rpartition = s1.rpartition
|
|
for x in _RANGE_100:
|
|
s1_rpartition(s2)
|
|
|
|
|
|
#### Same for split(s, 1)
|
|
|
|
@bench('("A"*1000).split("A", 1)', "early match, single character", 1000)
|
|
def split_test_quick_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("A")
|
|
s1_split = s1.split
|
|
for x in _RANGE_1000:
|
|
s1_split(s2, 1)
|
|
|
|
@bench('("A"*1000).split("B", 1)', "no match, single character", 1000)
|
|
def split_test_no_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("B")
|
|
s1_split = s1.split
|
|
for x in _RANGE_1000:
|
|
s1_split(s2, 1)
|
|
|
|
|
|
@bench('("AB"*1000).split("AB", 1)', "early match, two characters", 1000)
|
|
def split_test_quick_match_two_characters(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("AB")
|
|
s1_split = s1.split
|
|
for x in _RANGE_1000:
|
|
s1_split(s2, 1)
|
|
|
|
@bench('("AB"*1000).split("BC", 1)', "no match, two characters", 1000)
|
|
def split_test_no_match_two_character(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("BC")
|
|
s1_split = s1.split
|
|
for x in _RANGE_1000:
|
|
s1_split(s2, 1)
|
|
|
|
@bench('("AB"*300+"C").split("BC", 1)', "late match, two characters", 1000)
|
|
def split_test_slow_match_two_characters(STR):
|
|
s1 = STR("AB" * 300+"C")
|
|
s2 = STR("BC")
|
|
s1_split = s1.split
|
|
for x in _RANGE_1000:
|
|
s1_split(s2, 1)
|
|
|
|
@bench('s="ABC"*33; ((s+"D")*500+s+"E").split(s+"E", 1)',
|
|
"late match, 100 characters", 100)
|
|
def split_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = (m+d)*500 + m+e
|
|
s2 = m+e
|
|
s1_split = s1.split
|
|
for x in _RANGE_100:
|
|
s1_split(s2, 1)
|
|
|
|
|
|
#### Same for rsplit(s, 1)
|
|
|
|
@bench('("A"*1000).rsplit("A", 1)', "early match, single character", 1000)
|
|
def rsplit_test_quick_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("A")
|
|
s1_rsplit = s1.rsplit
|
|
for x in _RANGE_1000:
|
|
s1_rsplit(s2, 1)
|
|
|
|
@bench('("A"*1000).rsplit("B", 1)', "no match, single character", 1000)
|
|
def rsplit_test_no_match_single_character(STR):
|
|
s1 = STR("A" * 1000)
|
|
s2 = STR("B")
|
|
s1_rsplit = s1.rsplit
|
|
for x in _RANGE_1000:
|
|
s1_rsplit(s2, 1)
|
|
|
|
|
|
@bench('("AB"*1000).rsplit("AB", 1)', "early match, two characters", 1000)
|
|
def rsplit_test_quick_match_two_characters(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("AB")
|
|
s1_rsplit = s1.rsplit
|
|
for x in _RANGE_1000:
|
|
s1_rsplit(s2, 1)
|
|
|
|
@bench('("AB"*1000).rsplit("BC", 1)', "no match, two characters", 1000)
|
|
def rsplit_test_no_match_two_character(STR):
|
|
s1 = STR("AB" * 1000)
|
|
s2 = STR("BC")
|
|
s1_rsplit = s1.rsplit
|
|
for x in _RANGE_1000:
|
|
s1_rsplit(s2, 1)
|
|
|
|
@bench('("C"+"AB"*300).rsplit("CA", 1)', "late match, two characters", 1000)
|
|
def rsplit_test_slow_match_two_characters(STR):
|
|
s1 = STR("C" + "AB" * 300)
|
|
s2 = STR("CA")
|
|
s1_rsplit = s1.rsplit
|
|
for x in _RANGE_1000:
|
|
s1_rsplit(s2, 1)
|
|
|
|
@bench('s="ABC"*33; ("E"+s+("D"+s)*500).rsplit("E"+s, 1)',
|
|
"late match, 100 characters", 100)
|
|
def rsplit_test_slow_match_100_characters(STR):
|
|
m = STR("ABC"*33)
|
|
d = STR("D")
|
|
e = STR("E")
|
|
s1 = e + m + (d+m)*500
|
|
s2 = e + m
|
|
s1_rsplit = s1.rsplit
|
|
for x in _RANGE_100:
|
|
s1_rsplit(s2, 1)
|
|
|
|
|
|
#### Benchmark the operator-based methods
|
|
|
|
@bench('"A"*10', "repeat 1 character 10 times", 1000)
|
|
def repeat_single_10_times(STR):
|
|
s = STR("A")
|
|
for x in _RANGE_1000:
|
|
s * 10
|
|
|
|
@bench('"A"*1000', "repeat 1 character 1000 times", 1000)
|
|
def repeat_single_1000_times(STR):
|
|
s = STR("A")
|
|
for x in _RANGE_1000:
|
|
s * 1000
|
|
|
|
@bench('"ABCDE"*10', "repeat 5 characters 10 times", 1000)
|
|
def repeat_5_10_times(STR):
|
|
s = STR("ABCDE")
|
|
for x in _RANGE_1000:
|
|
s * 10
|
|
|
|
@bench('"ABCDE"*1000', "repeat 5 characters 1000 times", 1000)
|
|
def repeat_5_1000_times(STR):
|
|
s = STR("ABCDE")
|
|
for x in _RANGE_1000:
|
|
s * 1000
|
|
|
|
# + for concat
|
|
|
|
@bench('"Andrew"+"Dalke"', "concat two strings", 1000)
|
|
def concat_two_strings(STR):
|
|
s1 = STR("Andrew")
|
|
s2 = STR("Dalke")
|
|
for x in _RANGE_1000:
|
|
s1+s2
|
|
|
|
@bench('s1+s2+s3+s4+...+s20', "concat 20 strings of words length 4 to 15",
|
|
1000)
|
|
def concat_many_strings(STR):
|
|
s1=STR('TIXSGYNREDCVBHJ')
|
|
s2=STR('PUMTLXBZVDO')
|
|
s3=STR('FVZNJ')
|
|
s4=STR('OGDXUW')
|
|
s5=STR('WEIMRNCOYVGHKB')
|
|
s6=STR('FCQTNMXPUZH')
|
|
s7=STR('TICZJYRLBNVUEAK')
|
|
s8=STR('REYB')
|
|
s9=STR('PWUOQ')
|
|
s10=STR('EQHCMKBS')
|
|
s11=STR('AEVDFOH')
|
|
s12=STR('IFHVD')
|
|
s13=STR('JGTCNLXWOHQ')
|
|
s14=STR('ITSKEPYLROZAWXF')
|
|
s15=STR('THEK')
|
|
s16=STR('GHPZFBUYCKMNJIT')
|
|
s17=STR('JMUZ')
|
|
s18=STR('WLZQMTB')
|
|
s19=STR('KPADCBW')
|
|
s20=STR('TNJHZQAGBU')
|
|
for x in _RANGE_1000:
|
|
(s1 + s2+ s3+ s4+ s5+ s6+ s7+ s8+ s9+s10+
|
|
s11+s12+s13+s14+s15+s16+s17+s18+s19+s20)
|
|
|
|
|
|
#### Benchmark join
|
|
|
|
def get_bytes_yielding_seq(STR, arg):
|
|
if STR is BYTES and sys.version_info >= (3,):
|
|
raise UnsupportedType
|
|
return STR(arg)
|
|
|
|
@bench('"A".join("")',
|
|
"join empty string, with 1 character sep", 100)
|
|
def join_empty_single(STR):
|
|
sep = STR("A")
|
|
s2 = get_bytes_yielding_seq(STR, "")
|
|
sep_join = sep.join
|
|
for x in _RANGE_100:
|
|
sep_join(s2)
|
|
|
|
@bench('"ABCDE".join("")',
|
|
"join empty string, with 5 character sep", 100)
|
|
def join_empty_5(STR):
|
|
sep = STR("ABCDE")
|
|
s2 = get_bytes_yielding_seq(STR, "")
|
|
sep_join = sep.join
|
|
for x in _RANGE_100:
|
|
sep_join(s2)
|
|
|
|
@bench('"A".join("ABC..Z")',
|
|
"join string with 26 characters, with 1 character sep", 1000)
|
|
def join_alphabet_single(STR):
|
|
sep = STR("A")
|
|
s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ")
|
|
sep_join = sep.join
|
|
for x in _RANGE_1000:
|
|
sep_join(s2)
|
|
|
|
@bench('"ABCDE".join("ABC..Z")',
|
|
"join string with 26 characters, with 5 character sep", 1000)
|
|
def join_alphabet_5(STR):
|
|
sep = STR("ABCDE")
|
|
s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ")
|
|
sep_join = sep.join
|
|
for x in _RANGE_1000:
|
|
sep_join(s2)
|
|
|
|
@bench('"A".join(list("ABC..Z"))',
|
|
"join list of 26 characters, with 1 character sep", 1000)
|
|
def join_alphabet_list_single(STR):
|
|
sep = STR("A")
|
|
s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"]
|
|
sep_join = sep.join
|
|
for x in _RANGE_1000:
|
|
sep_join(s2)
|
|
|
|
@bench('"ABCDE".join(list("ABC..Z"))',
|
|
"join list of 26 characters, with 5 character sep", 1000)
|
|
def join_alphabet_list_five(STR):
|
|
sep = STR("ABCDE")
|
|
s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"]
|
|
sep_join = sep.join
|
|
for x in _RANGE_1000:
|
|
sep_join(s2)
|
|
|
|
@bench('"A".join(["Bob"]*100))',
|
|
"join list of 100 words, with 1 character sep", 1000)
|
|
def join_100_words_single(STR):
|
|
sep = STR("A")
|
|
s2 = [STR("Bob")]*100
|
|
sep_join = sep.join
|
|
for x in _RANGE_1000:
|
|
sep_join(s2)
|
|
|
|
@bench('"ABCDE".join(["Bob"]*100))',
|
|
"join list of 100 words, with 5 character sep", 1000)
|
|
def join_100_words_5(STR):
|
|
sep = STR("ABCDE")
|
|
s2 = [STR("Bob")]*100
|
|
sep_join = sep.join
|
|
for x in _RANGE_1000:
|
|
sep_join(s2)
|
|
|
|
#### split tests
|
|
|
|
@bench('("Here are some words. "*2).split()', "split whitespace (small)", 1000)
|
|
def whitespace_split(STR):
|
|
s = STR("Here are some words. "*2)
|
|
s_split = s.split
|
|
for x in _RANGE_1000:
|
|
s_split()
|
|
|
|
@bench('("Here are some words. "*2).rsplit()', "split whitespace (small)", 1000)
|
|
def whitespace_rsplit(STR):
|
|
s = STR("Here are some words. "*2)
|
|
s_rsplit = s.rsplit
|
|
for x in _RANGE_1000:
|
|
s_rsplit()
|
|
|
|
@bench('("Here are some words. "*2).split(None, 1)',
|
|
"split 1 whitespace", 1000)
|
|
def whitespace_split_1(STR):
|
|
s = STR("Here are some words. "*2)
|
|
s_split = s.split
|
|
N = None
|
|
for x in _RANGE_1000:
|
|
s_split(N, 1)
|
|
|
|
@bench('("Here are some words. "*2).rsplit(None, 1)',
|
|
"split 1 whitespace", 1000)
|
|
def whitespace_rsplit_1(STR):
|
|
s = STR("Here are some words. "*2)
|
|
s_rsplit = s.rsplit
|
|
N = None
|
|
for x in _RANGE_1000:
|
|
s_rsplit(N, 1)
|
|
|
|
@bench('("Here are some words. "*2).partition(" ")',
|
|
"split 1 whitespace", 1000)
|
|
def whitespace_partition(STR):
|
|
sep = STR(" ")
|
|
s = STR("Here are some words. "*2)
|
|
s_partition = s.partition
|
|
for x in _RANGE_1000:
|
|
s_partition(sep)
|
|
|
|
@bench('("Here are some words. "*2).rpartition(" ")',
|
|
"split 1 whitespace", 1000)
|
|
def whitespace_rpartition(STR):
|
|
sep = STR(" ")
|
|
s = STR("Here are some words. "*2)
|
|
s_rpartition = s.rpartition
|
|
for x in _RANGE_1000:
|
|
s_rpartition(sep)
|
|
|
|
human_text = """\
|
|
Python is a dynamic object-oriented programming language that can be
|
|
used for many kinds of software development. It offers strong support
|
|
for integration with other languages and tools, comes with extensive
|
|
standard libraries, and can be learned in a few days. Many Python
|
|
programmers report substantial productivity gains and feel the language
|
|
encourages the development of higher quality, more maintainable code.
|
|
|
|
Python runs on Windows, Linux/Unix, Mac OS X, Amiga, Palm
|
|
Handhelds, and Nokia mobile phones. Python has also been ported to the
|
|
Java and .NET virtual machines.
|
|
|
|
Python is distributed under an OSI-approved open source license that
|
|
makes it free to use, even for commercial products.
|
|
"""*25
|
|
human_text_bytes = bytes_from_str(human_text)
|
|
human_text_unicode = unicode_from_str(human_text)
|
|
def _get_human_text(STR):
|
|
if STR is UNICODE:
|
|
return human_text_unicode
|
|
if STR is BYTES:
|
|
return human_text_bytes
|
|
raise AssertionError
|
|
|
|
@bench('human_text.split()', "split whitespace (huge)", 10)
|
|
def whitespace_split_huge(STR):
|
|
s = _get_human_text(STR)
|
|
s_split = s.split
|
|
for x in _RANGE_10:
|
|
s_split()
|
|
|
|
@bench('human_text.rsplit()', "split whitespace (huge)", 10)
|
|
def whitespace_rsplit_huge(STR):
|
|
s = _get_human_text(STR)
|
|
s_rsplit = s.rsplit
|
|
for x in _RANGE_10:
|
|
s_rsplit()
|
|
|
|
|
|
|
|
@bench('"this\\nis\\na\\ntest\\n".split("\\n")', "split newlines", 1000)
|
|
def newlines_split(STR):
|
|
s = STR("this\nis\na\ntest\n")
|
|
s_split = s.split
|
|
nl = STR("\n")
|
|
for x in _RANGE_1000:
|
|
s_split(nl)
|
|
|
|
|
|
@bench('"this\\nis\\na\\ntest\\n".rsplit("\\n")', "split newlines", 1000)
|
|
def newlines_rsplit(STR):
|
|
s = STR("this\nis\na\ntest\n")
|
|
s_rsplit = s.rsplit
|
|
nl = STR("\n")
|
|
for x in _RANGE_1000:
|
|
s_rsplit(nl)
|
|
|
|
@bench('"this\\nis\\na\\ntest\\n".splitlines()', "split newlines", 1000)
|
|
def newlines_splitlines(STR):
|
|
s = STR("this\nis\na\ntest\n")
|
|
s_splitlines = s.splitlines
|
|
for x in _RANGE_1000:
|
|
s_splitlines()
|
|
|
|
## split text with 2000 newlines
|
|
|
|
def _make_2000_lines():
|
|
import random
|
|
r = random.Random(100)
|
|
chars = list(map(chr, range(32, 128)))
|
|
i = 0
|
|
while i < len(chars):
|
|
chars[i] = " "
|
|
i += r.randrange(9)
|
|
s = "".join(chars)
|
|
s = s*4
|
|
words = []
|
|
for i in range(2000):
|
|
start = r.randrange(96)
|
|
n = r.randint(5, 65)
|
|
words.append(s[start:start+n])
|
|
return "\n".join(words)+"\n"
|
|
|
|
_text_with_2000_lines = _make_2000_lines()
|
|
_text_with_2000_lines_bytes = bytes_from_str(_text_with_2000_lines)
|
|
_text_with_2000_lines_unicode = unicode_from_str(_text_with_2000_lines)
|
|
def _get_2000_lines(STR):
|
|
if STR is UNICODE:
|
|
return _text_with_2000_lines_unicode
|
|
if STR is BYTES:
|
|
return _text_with_2000_lines_bytes
|
|
raise AssertionError
|
|
|
|
|
|
@bench('"...text...".split("\\n")', "split 2000 newlines", 10)
|
|
def newlines_split_2000(STR):
|
|
s = _get_2000_lines(STR)
|
|
s_split = s.split
|
|
nl = STR("\n")
|
|
for x in _RANGE_10:
|
|
s_split(nl)
|
|
|
|
@bench('"...text...".rsplit("\\n")', "split 2000 newlines", 10)
|
|
def newlines_rsplit_2000(STR):
|
|
s = _get_2000_lines(STR)
|
|
s_rsplit = s.rsplit
|
|
nl = STR("\n")
|
|
for x in _RANGE_10:
|
|
s_rsplit(nl)
|
|
|
|
@bench('"...text...".splitlines()', "split 2000 newlines", 10)
|
|
def newlines_splitlines_2000(STR):
|
|
s = _get_2000_lines(STR)
|
|
s_splitlines = s.splitlines
|
|
for x in _RANGE_10:
|
|
s_splitlines()
|
|
|
|
|
|
## split text on "--" characters
|
|
@bench(
|
|
'"this--is--a--test--of--the--emergency--broadcast--system".split("--")',
|
|
"split on multicharacter separator (small)", 1000)
|
|
def split_multichar_sep_small(STR):
|
|
s = STR("this--is--a--test--of--the--emergency--broadcast--system")
|
|
s_split = s.split
|
|
pat = STR("--")
|
|
for x in _RANGE_1000:
|
|
s_split(pat)
|
|
@bench(
|
|
'"this--is--a--test--of--the--emergency--broadcast--system".rsplit("--")',
|
|
"split on multicharacter separator (small)", 1000)
|
|
def rsplit_multichar_sep_small(STR):
|
|
s = STR("this--is--a--test--of--the--emergency--broadcast--system")
|
|
s_rsplit = s.rsplit
|
|
pat = STR("--")
|
|
for x in _RANGE_1000:
|
|
s_rsplit(pat)
|
|
|
|
## split dna text on "ACTAT" characters
|
|
@bench('dna.split("ACTAT")',
|
|
"split on multicharacter separator (dna)", 10)
|
|
def split_multichar_sep_dna(STR):
|
|
s = _get_dna(STR)
|
|
s_split = s.split
|
|
pat = STR("ACTAT")
|
|
for x in _RANGE_10:
|
|
s_split(pat)
|
|
|
|
@bench('dna.rsplit("ACTAT")',
|
|
"split on multicharacter separator (dna)", 10)
|
|
def rsplit_multichar_sep_dna(STR):
|
|
s = _get_dna(STR)
|
|
s_rsplit = s.rsplit
|
|
pat = STR("ACTAT")
|
|
for x in _RANGE_10:
|
|
s_rsplit(pat)
|
|
|
|
|
|
|
|
## split with limits
|
|
|
|
GFF3_example = "\t".join([
|
|
"I", "Genomic_canonical", "region", "357208", "396183", ".", "+", ".",
|
|
"ID=Sequence:R119;note=Clone R119%3B Genbank AF063007;Name=R119"])
|
|
|
|
@bench('GFF3_example.split("\\t")', "tab split", 1000)
|
|
def tab_split_no_limit(STR):
|
|
sep = STR("\t")
|
|
s = STR(GFF3_example)
|
|
s_split = s.split
|
|
for x in _RANGE_1000:
|
|
s_split(sep)
|
|
|
|
@bench('GFF3_example.split("\\t", 8)', "tab split", 1000)
|
|
def tab_split_limit(STR):
|
|
sep = STR("\t")
|
|
s = STR(GFF3_example)
|
|
s_split = s.split
|
|
for x in _RANGE_1000:
|
|
s_split(sep, 8)
|
|
|
|
@bench('GFF3_example.rsplit("\\t")', "tab split", 1000)
|
|
def tab_rsplit_no_limit(STR):
|
|
sep = STR("\t")
|
|
s = STR(GFF3_example)
|
|
s_rsplit = s.rsplit
|
|
for x in _RANGE_1000:
|
|
s_rsplit(sep)
|
|
|
|
@bench('GFF3_example.rsplit("\\t", 8)', "tab split", 1000)
|
|
def tab_rsplit_limit(STR):
|
|
sep = STR("\t")
|
|
s = STR(GFF3_example)
|
|
s_rsplit = s.rsplit
|
|
for x in _RANGE_1000:
|
|
s_rsplit(sep, 8)
|
|
|
|
#### Count characters
|
|
|
|
@bench('...text.with.2000.newlines.count("\\n")',
|
|
"count newlines", 10)
|
|
def count_newlines(STR):
|
|
s = _get_2000_lines(STR)
|
|
s_count = s.count
|
|
nl = STR("\n")
|
|
for x in _RANGE_10:
|
|
s_count(nl)
|
|
|
|
# Orchid sequences concatenated, from Biopython
|
|
_dna = """
|
|
CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGGGTT
|
|
AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAATTGCCATCG
|
|
AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCTCCAAGTCGTT
|
|
TGACACATAATTGGTGAAGGGGGTGGCATCCTTCCCTGACCCTCCCCCAACTATTTTTTTAACAACTCTC
|
|
AGCAACGGAGACTCAGTCTTCGGCAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGCACCATCGAG
|
|
TCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATAT
|
|
CTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTT
|
|
TGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTAT
|
|
GCTACAACAAAATTGTTGTGCAGAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGACCC
|
|
TTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGGTCAG
|
|
GTGAGCAACAGCTGTCGTAACAAGGTTTCCGTAGGGTGAACTGCGGAAGGATCATTGTTGAGATCACATA
|
|
ATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGAC
|
|
CTAGATTTGCCATCGAGCCTCCTTGGGAGCATCCTTGTTGGCGATATCTAAACCCTCAATTTTTCCCCCA
|
|
ATCAAATTACACAAAATTGGTGGAGGGGGTGGCATTCTTCCCTTACCCTCCCCCAAATATTTTTTTAACA
|
|
ACTCTCAGCAACGGATATCTCAGCTCTTGCATCGATGAAGAACCCACCGAAATGCGATAAATGGTGTGAA
|
|
TTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACG
|
|
CCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCG
|
|
GATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGATGCATGGGCTTTTGATGGTCCTAA
|
|
ATACGGCAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATAAG
|
|
ATGGGCCACCGATATCTGAAGACCCTTTTGGACCCCATTGGAGCCCATCAACCCATGTCAGTTGATGGCC
|
|
ATTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGA
|
|
GTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCA
|
|
TCGAGCCTCCTTGGGAGCTTTCTTGTTGGCGATATCTAAACCCTTGCCCGGCAGAGTTTTGGGAATCCCG
|
|
TGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCAT
|
|
TGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACACACCTGTTCAGCCGGTGCGGATGTGAGTTTG
|
|
GCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAG
|
|
GTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCAT
|
|
AATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGC
|
|
GACCCAGTCAGGTGAGGGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAG
|
|
TTAATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCAT
|
|
CGAGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTTGGCGCCAAGTCA
|
|
TATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTC
|
|
TCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGC
|
|
AGAATCCCGTGAACCATCGAGTCTTTGGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCT
|
|
GCCTGGGCATTGGGAATCATATCTCTCCCCTAACGAGGCTATCCAAACATACTGTTCATCCGGTGCGGAT
|
|
GTGAGTTTGGCCCCTTGTTCTTTGGTACCGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTCAAAA
|
|
CGGCAAGAGGTGGACGAACTATGCCACAACAAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTAGATG
|
|
GGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGACCA
|
|
TTTGTTGCGACCCCAGTCAGCTGAGCAACCCGCTGAGTGGAAGGTCATTGCCGATATCACATAATAATTG
|
|
ATCGAGTTAATCTGGAGGATCTGTTTACTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTT
|
|
GCCATCGAGCCTCCTTGGGAGTTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTGTGCGCCA
|
|
AGTCATATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAAC
|
|
AACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGA
|
|
ATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCAC
|
|
GCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCATCCGGTGC
|
|
GGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTC
|
|
AAAACGGCAAGAGGTGGACGAACTATGCTACAACCAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTA
|
|
GATGGGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATG
|
|
ACCATGTGTTGCGACCCCAGTCAGCTGAGCAACGCGCTGAGCGTAACAAGGTTTCCGTAGGTGGACCTCC
|
|
GGGAGGATCATTGTTGAGATCACATAATAATTGATCGAGGTAATCTGGAGGATCTGCATATTTTGGTCAC
|
|
"""
|
|
_dna = "".join(_dna.splitlines())
|
|
_dna = _dna * 25
|
|
_dna_bytes = bytes_from_str(_dna)
|
|
_dna_unicode = unicode_from_str(_dna)
|
|
|
|
def _get_dna(STR):
|
|
if STR is UNICODE:
|
|
return _dna_unicode
|
|
if STR is BYTES:
|
|
return _dna_bytes
|
|
raise AssertionError
|
|
|
|
@bench('dna.count("AACT")', "count AACT substrings in DNA example", 10)
|
|
def count_aact(STR):
|
|
seq = _get_dna(STR)
|
|
seq_count = seq.count
|
|
needle = STR("AACT")
|
|
for x in _RANGE_10:
|
|
seq_count(needle)
|
|
|
|
##### startswith and endswith
|
|
|
|
@bench('"Andrew".startswith("A")', 'startswith single character', 1000)
|
|
def startswith_single(STR):
|
|
s1 = STR("Andrew")
|
|
s2 = STR("A")
|
|
s1_startswith = s1.startswith
|
|
for x in _RANGE_1000:
|
|
s1_startswith(s2)
|
|
|
|
@bench('"Andrew".startswith("Andrew")', 'startswith multiple characters',
|
|
1000)
|
|
def startswith_multiple(STR):
|
|
s1 = STR("Andrew")
|
|
s2 = STR("Andrew")
|
|
s1_startswith = s1.startswith
|
|
for x in _RANGE_1000:
|
|
s1_startswith(s2)
|
|
|
|
@bench('"Andrew".startswith("Anders")',
|
|
'startswith multiple characters - not!', 1000)
|
|
def startswith_multiple_not(STR):
|
|
s1 = STR("Andrew")
|
|
s2 = STR("Anders")
|
|
s1_startswith = s1.startswith
|
|
for x in _RANGE_1000:
|
|
s1_startswith(s2)
|
|
|
|
|
|
# endswith
|
|
|
|
@bench('"Andrew".endswith("w")', 'endswith single character', 1000)
|
|
def endswith_single(STR):
|
|
s1 = STR("Andrew")
|
|
s2 = STR("w")
|
|
s1_endswith = s1.endswith
|
|
for x in _RANGE_1000:
|
|
s1_endswith(s2)
|
|
|
|
@bench('"Andrew".endswith("Andrew")', 'endswith multiple characters', 1000)
|
|
def endswith_multiple(STR):
|
|
s1 = STR("Andrew")
|
|
s2 = STR("Andrew")
|
|
s1_endswith = s1.endswith
|
|
for x in _RANGE_1000:
|
|
s1_endswith(s2)
|
|
|
|
@bench('"Andrew".endswith("Anders")',
|
|
'endswith multiple characters - not!', 1000)
|
|
def endswith_multiple_not(STR):
|
|
s1 = STR("Andrew")
|
|
s2 = STR("Anders")
|
|
s1_endswith = s1.endswith
|
|
for x in _RANGE_1000:
|
|
s1_endswith(s2)
|
|
|
|
#### Strip
|
|
|
|
@bench('"Hello!\\n".strip()', 'strip terminal newline', 1000)
|
|
def terminal_newline_strip_right(STR):
|
|
s = STR("Hello!\n")
|
|
s_strip = s.strip
|
|
for x in _RANGE_1000:
|
|
s_strip()
|
|
|
|
@bench('"Hello!\\n".rstrip()', 'strip terminal newline', 1000)
|
|
def terminal_newline_rstrip(STR):
|
|
s = STR("Hello!\n")
|
|
s_rstrip = s.rstrip
|
|
for x in _RANGE_1000:
|
|
s_rstrip()
|
|
|
|
@bench('"\\nHello!".strip()', 'strip terminal newline', 1000)
|
|
def terminal_newline_strip_left(STR):
|
|
s = STR("\nHello!")
|
|
s_strip = s.strip
|
|
for x in _RANGE_1000:
|
|
s_strip()
|
|
|
|
@bench('"\\nHello!\\n".strip()', 'strip terminal newline', 1000)
|
|
def terminal_newline_strip_both(STR):
|
|
s = STR("\nHello!\n")
|
|
s_strip = s.strip
|
|
for x in _RANGE_1000:
|
|
s_strip()
|
|
|
|
@bench('"\\nHello!".rstrip()', 'strip terminal newline', 1000)
|
|
def terminal_newline_lstrip(STR):
|
|
s = STR("\nHello!")
|
|
s_lstrip = s.lstrip
|
|
for x in _RANGE_1000:
|
|
s_lstrip()
|
|
|
|
@bench('s="Hello!\\n"; s[:-1] if s[-1]=="\\n" else s',
|
|
'strip terminal newline', 1000)
|
|
def terminal_newline_if_else(STR):
|
|
s = STR("Hello!\n")
|
|
NL = STR("\n")
|
|
for x in _RANGE_1000:
|
|
s[:-1] if (s[-1] == NL) else s
|
|
|
|
|
|
# Strip multiple spaces or tabs
|
|
|
|
@bench('"Hello\\t \\t".strip()', 'strip terminal spaces and tabs', 1000)
|
|
def terminal_space_strip(STR):
|
|
s = STR("Hello\t \t!")
|
|
s_strip = s.strip
|
|
for x in _RANGE_1000:
|
|
s_strip()
|
|
|
|
@bench('"Hello\\t \\t".rstrip()', 'strip terminal spaces and tabs', 1000)
|
|
def terminal_space_rstrip(STR):
|
|
s = STR("Hello!\t \t")
|
|
s_rstrip = s.rstrip
|
|
for x in _RANGE_1000:
|
|
s_rstrip()
|
|
|
|
@bench('"\\t \\tHello".rstrip()', 'strip terminal spaces and tabs', 1000)
|
|
def terminal_space_lstrip(STR):
|
|
s = STR("\t \tHello!")
|
|
s_lstrip = s.lstrip
|
|
for x in _RANGE_1000:
|
|
s_lstrip()
|
|
|
|
|
|
#### replace
|
|
@bench('"This is a test".replace(" ", "\\t")', 'replace single character',
|
|
1000)
|
|
def replace_single_character(STR):
|
|
s = STR("This is a test!")
|
|
from_str = STR(" ")
|
|
to_str = STR("\t")
|
|
s_replace = s.replace
|
|
for x in _RANGE_1000:
|
|
s_replace(from_str, to_str)
|
|
|
|
@uses_re
|
|
@bench('re.sub(" ", "\\t", "This is a test"', 'replace single character',
|
|
1000)
|
|
def replace_single_character_re(STR):
|
|
s = STR("This is a test!")
|
|
pat = re.compile(STR(" "))
|
|
to_str = STR("\t")
|
|
pat_sub = pat.sub
|
|
for x in _RANGE_1000:
|
|
pat_sub(to_str, s)
|
|
|
|
@bench('"...text.with.2000.lines...replace("\\n", " ")',
|
|
'replace single character, big string', 10)
|
|
def replace_single_character_big(STR):
|
|
s = _get_2000_lines(STR)
|
|
from_str = STR("\n")
|
|
to_str = STR(" ")
|
|
s_replace = s.replace
|
|
for x in _RANGE_10:
|
|
s_replace(from_str, to_str)
|
|
|
|
@uses_re
|
|
@bench('re.sub("\\n", " ", "...text.with.2000.lines...")',
|
|
'replace single character, big string', 10)
|
|
def replace_single_character_big_re(STR):
|
|
s = _get_2000_lines(STR)
|
|
pat = re.compile(STR("\n"))
|
|
to_str = STR(" ")
|
|
pat_sub = pat.sub
|
|
for x in _RANGE_10:
|
|
pat_sub(to_str, s)
|
|
|
|
|
|
@bench('dna.replace("ATC", "ATT")',
|
|
'replace multiple characters, dna', 10)
|
|
def replace_multiple_characters_dna(STR):
|
|
seq = _get_dna(STR)
|
|
from_str = STR("ATC")
|
|
to_str = STR("ATT")
|
|
seq_replace = seq.replace
|
|
for x in _RANGE_10:
|
|
seq_replace(from_str, to_str)
|
|
|
|
# This increases the character count
|
|
@bench('"...text.with.2000.newlines...replace("\\n", "\\r\\n")',
|
|
'replace and expand multiple characters, big string', 10)
|
|
def replace_multiple_character_big(STR):
|
|
s = _get_2000_lines(STR)
|
|
from_str = STR("\n")
|
|
to_str = STR("\r\n")
|
|
s_replace = s.replace
|
|
for x in _RANGE_10:
|
|
s_replace(from_str, to_str)
|
|
|
|
|
|
# This decreases the character count
|
|
@bench('"When shall we three meet again?".replace("ee", "")',
|
|
'replace/remove multiple characters', 1000)
|
|
def replace_multiple_character_remove(STR):
|
|
s = STR("When shall we three meet again?")
|
|
from_str = STR("ee")
|
|
to_str = STR("")
|
|
s_replace = s.replace
|
|
for x in _RANGE_1000:
|
|
s_replace(from_str, to_str)
|
|
|
|
|
|
big_s = "A" + ("Z"*128*1024)
|
|
big_s_bytes = bytes_from_str(big_s)
|
|
big_s_unicode = unicode_from_str(big_s)
|
|
def _get_big_s(STR):
|
|
if STR is UNICODE: return big_s_unicode
|
|
if STR is BYTES: return big_s_bytes
|
|
raise AssertionError
|
|
|
|
# The older replace implementation counted all matches in
|
|
# the string even when it only neeed to make one replacement.
|
|
@bench('("A" + ("Z"*128*1024)).replace("A", "BB", 1)',
|
|
'quick replace single character match', 10)
|
|
def quick_replace_single_match(STR):
|
|
s = _get_big_s(STR)
|
|
from_str = STR("A")
|
|
to_str = STR("BB")
|
|
s_replace = s.replace
|
|
for x in _RANGE_10:
|
|
s_replace(from_str, to_str, 1)
|
|
|
|
@bench('("A" + ("Z"*128*1024)).replace("AZZ", "BBZZ", 1)',
|
|
'quick replace multiple character match', 10)
|
|
def quick_replace_multiple_match(STR):
|
|
s = _get_big_s(STR)
|
|
from_str = STR("AZZ")
|
|
to_str = STR("BBZZ")
|
|
s_replace = s.replace
|
|
for x in _RANGE_10:
|
|
s_replace(from_str, to_str, 1)
|
|
|
|
|
|
####
|
|
|
|
# CCP does a lot of this, for internationalisation of ingame messages.
|
|
_format = "The %(thing)s is %(place)s the %(location)s."
|
|
_format_dict = { "thing":"THING", "place":"PLACE", "location":"LOCATION", }
|
|
_format_bytes = bytes_from_str(_format)
|
|
_format_unicode = unicode_from_str(_format)
|
|
_format_dict_bytes = dict((bytes_from_str(k), bytes_from_str(v)) for (k,v) in _format_dict.items())
|
|
_format_dict_unicode = dict((unicode_from_str(k), unicode_from_str(v)) for (k,v) in _format_dict.items())
|
|
|
|
def _get_format(STR):
|
|
if STR is UNICODE:
|
|
return _format_unicode
|
|
if STR is BYTES:
|
|
if sys.version_info >= (3,):
|
|
raise UnsupportedType
|
|
return _format_bytes
|
|
raise AssertionError
|
|
|
|
def _get_format_dict(STR):
|
|
if STR is UNICODE:
|
|
return _format_dict_unicode
|
|
if STR is BYTES:
|
|
if sys.version_info >= (3,):
|
|
raise UnsupportedType
|
|
return _format_dict_bytes
|
|
raise AssertionError
|
|
|
|
# Formatting.
|
|
@bench('"The %(k1)s is %(k2)s the %(k3)s."%{"k1":"x","k2":"y","k3":"z",}',
|
|
'formatting a string type with a dict', 1000)
|
|
def format_with_dict(STR):
|
|
s = _get_format(STR)
|
|
d = _get_format_dict(STR)
|
|
for x in _RANGE_1000:
|
|
s % d
|
|
|
|
|
|
#### Upper- and lower- case conversion
|
|
|
|
@bench('("Where in the world is Carmen San Deigo?"*10).lower()',
|
|
"case conversion -- rare", 1000)
|
|
def lower_conversion_rare(STR):
|
|
s = STR("Where in the world is Carmen San Deigo?"*10)
|
|
s_lower = s.lower
|
|
for x in _RANGE_1000:
|
|
s_lower()
|
|
|
|
@bench('("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10).lower()',
|
|
"case conversion -- dense", 1000)
|
|
def lower_conversion_dense(STR):
|
|
s = STR("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10)
|
|
s_lower = s.lower
|
|
for x in _RANGE_1000:
|
|
s_lower()
|
|
|
|
|
|
@bench('("wHERE IN THE WORLD IS cARMEN sAN dEIGO?"*10).upper()',
|
|
"case conversion -- rare", 1000)
|
|
def upper_conversion_rare(STR):
|
|
s = STR("Where in the world is Carmen San Deigo?"*10)
|
|
s_upper = s.upper
|
|
for x in _RANGE_1000:
|
|
s_upper()
|
|
|
|
@bench('("where in the world is carmen san deigo?"*10).upper()',
|
|
"case conversion -- dense", 1000)
|
|
def upper_conversion_dense(STR):
|
|
s = STR("where in the world is carmen san deigo?"*10)
|
|
s_upper = s.upper
|
|
for x in _RANGE_1000:
|
|
s_upper()
|
|
|
|
|
|
# end of benchmarks
|
|
|
|
#################
|
|
|
|
class BenchTimer(timeit.Timer):
|
|
def best(self, repeat=1):
|
|
for i in range(1, 10):
|
|
number = 10**i
|
|
x = self.timeit(number)
|
|
if x > 0.02:
|
|
break
|
|
times = [x]
|
|
for i in range(1, repeat):
|
|
times.append(self.timeit(number))
|
|
return min(times) / number
|
|
|
|
def main():
|
|
(options, test_names) = parser.parse_args()
|
|
if options.bytes_only and options.unicode_only:
|
|
raise SystemExit("Only one of --8-bit and --unicode are allowed")
|
|
|
|
bench_functions = []
|
|
for (k,v) in globals().items():
|
|
if hasattr(v, "is_bench"):
|
|
if test_names:
|
|
for name in test_names:
|
|
if name in v.group:
|
|
break
|
|
else:
|
|
# Not selected, ignore
|
|
continue
|
|
if options.skip_re and hasattr(v, "uses_re"):
|
|
continue
|
|
|
|
bench_functions.append( (v.group, k, v) )
|
|
bench_functions.sort()
|
|
|
|
p("bytes\tunicode")
|
|
p("(in ms)\t(in ms)\t%\tcomment")
|
|
|
|
bytes_total = uni_total = 0.0
|
|
|
|
for title, group in itertools.groupby(bench_functions,
|
|
operator.itemgetter(0)):
|
|
# Flush buffer before each group
|
|
sys.stdout.flush()
|
|
p("="*10, title)
|
|
for (_, k, v) in group:
|
|
if hasattr(v, "is_bench"):
|
|
bytes_time = 0.0
|
|
bytes_time_s = " - "
|
|
if not options.unicode_only:
|
|
try:
|
|
bytes_time = BenchTimer("__main__.%s(__main__.BYTES)" % (k,),
|
|
"import __main__").best(REPEAT)
|
|
bytes_time_s = "%.2f" % (1000 * bytes_time)
|
|
bytes_total += bytes_time
|
|
except UnsupportedType:
|
|
bytes_time_s = "N/A"
|
|
uni_time = 0.0
|
|
uni_time_s = " - "
|
|
if not options.bytes_only:
|
|
try:
|
|
uni_time = BenchTimer("__main__.%s(__main__.UNICODE)" % (k,),
|
|
"import __main__").best(REPEAT)
|
|
uni_time_s = "%.2f" % (1000 * uni_time)
|
|
uni_total += uni_time
|
|
except UnsupportedType:
|
|
uni_time_s = "N/A"
|
|
try:
|
|
average = bytes_time/uni_time
|
|
except (TypeError, ZeroDivisionError):
|
|
average = 0.0
|
|
p("%s\t%s\t%.1f\t%s (*%d)" % (
|
|
bytes_time_s, uni_time_s, 100.*average,
|
|
v.comment, v.repeat_count))
|
|
|
|
if bytes_total == uni_total == 0.0:
|
|
p("That was zippy!")
|
|
else:
|
|
try:
|
|
ratio = bytes_total/uni_total
|
|
except ZeroDivisionError:
|
|
ratio = 0.0
|
|
p("%.2f\t%.2f\t%.1f\t%s" % (
|
|
1000*bytes_total, 1000*uni_total, 100.*ratio,
|
|
"TOTAL"))
|
|
|
|
if __name__ == "__main__":
|
|
main()
|